Transcript: Human NM_002412.5

Homo sapiens O-6-methylguanine-DNA methyltransferase (MGMT), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
MGMT (4255)
Length:
4678
CDS:
69..692

Additional Resources:

NCBI RefSeq record:
NM_002412.5
NBCI Gene record:
MGMT (4255)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002412.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427322 GAGCAGGGTCTGCACGAAATA pLKO_005 141 CDS 100% 13.200 18.480 N MGMT n/a
2 TRCN0000419534 TGAGCGACACACACGTGTAAC pLKO_005 716 3UTR 100% 10.800 15.120 N MGMT n/a
3 TRCN0000022367 TTACCAGCAATTAGCAGCCCT pLKO.1 407 CDS 100% 0.660 0.924 N MGMT n/a
4 TRCN0000039085 GCTGCTGAAGGTTGTGAAATT pLKO.1 371 CDS 100% 13.200 9.240 N Mgmt n/a
5 TRCN0000427501 TAACGCTGCCCTTGCTCTATT pLKO_005 886 3UTR 100% 13.200 9.240 N MGMT n/a
6 TRCN0000022368 GGAGGAGCAATGAGAGGCAAT pLKO.1 459 CDS 100% 4.050 2.835 N MGMT n/a
7 TRCN0000022365 TCTTACCAGCAATTAGCAGCC pLKO.1 405 CDS 100% 1.200 0.840 N MGMT n/a
8 TRCN0000022366 CTTACCAGCAATTAGCAGCCC pLKO.1 406 CDS 100% 0.540 0.378 N MGMT n/a
9 TRCN0000413668 AGCCTGGCTGAATGCCTATTT pLKO_005 257 CDS 100% 13.200 7.920 N MGMT n/a
10 TRCN0000022364 GCTGTATTAAAGGAAGTGGCA pLKO.1 767 3UTR 100% 0.660 0.396 N MGMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002412.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.