Transcript: Human NM_002439.5

Homo sapiens mutS homolog 3 (MSH3), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MSH3 (4437)
Length:
4443
CDS:
77..3490

Additional Resources:

NCBI RefSeq record:
NM_002439.5
NBCI Gene record:
MSH3 (4437)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002439.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422609 AGCCCGAGAGCTCAATATTTA pLKO_005 874 CDS 100% 15.000 21.000 N MSH3 n/a
2 TRCN0000084062 GCAAGGAGTTATGGATTAAAT pLKO.1 3269 CDS 100% 15.000 21.000 N MSH3 n/a
3 TRCN0000425424 TATGCTACACTTGAGTATTTC pLKO_005 3047 CDS 100% 13.200 18.480 N MSH3 n/a
4 TRCN0000084061 CCACTCCTTAAATTAAGGGAA pLKO.1 1823 CDS 100% 2.640 2.112 N MSH3 n/a
5 TRCN0000084059 GCCATTTAGATCACAACTTTA pLKO.1 897 CDS 100% 13.200 9.240 N MSH3 n/a
6 TRCN0000436457 TACGTAAATTGCCCGACATAG pLKO_005 1920 CDS 100% 10.800 7.560 N MSH3 n/a
7 TRCN0000174683 GAGTTGTGAAGCAAACTGAAA pLKO.1 990 CDS 100% 4.950 3.465 N Msh3 n/a
8 TRCN0000084058 GCACAGAAGGAATAAGGTCAT pLKO.1 4314 3UTR 100% 4.050 2.835 N MSH3 n/a
9 TRCN0000417959 ATACCAACTGATTGGGTAAAG pLKO_005 2366 CDS 100% 10.800 6.480 N MSH3 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3969 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002439.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.