Transcript: Human NM_002457.4

Homo sapiens mucin 2, oligomeric mucus/gel-forming (MUC2), mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
MUC2 (4583)
Length:
16050
CDS:
28..15897

Additional Resources:

NCBI RefSeq record:
NM_002457.4
NBCI Gene record:
MUC2 (4583)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002457.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073552 CGACTACAAGATACGTGTCAA pLKO.1 4167 CDS 100% 4.950 6.930 N MUC2 n/a
2 TRCN0000073548 CGGAGTTTACATCGACAACTA pLKO.1 13911 CDS 100% 4.950 6.930 N MUC2 n/a
3 TRCN0000073551 CGAGGCTCCTACAAGGAATTT pLKO.1 229 CDS 100% 13.200 9.240 N MUC2 n/a
4 TRCN0000073549 CGTCCATAACAACGACCTGTA pLKO.1 2493 CDS 100% 4.050 2.835 N MUC2 n/a
5 TRCN0000073550 GCTCTCCAATAACCACCACAA pLKO.1 5144 CDS 100% 4.050 2.835 N MUC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002457.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.