Transcript: Human NM_002466.4

Homo sapiens MYB proto-oncogene like 2 (MYBL2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
MYBL2 (4605)
Length:
2668
CDS:
171..2273

Additional Resources:

NCBI RefSeq record:
NM_002466.4
NBCI Gene record:
MYBL2 (4605)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002466.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020519 GCTAACAACAAAGTTCCACTT pLKO.1 2470 3UTR 100% 4.050 5.670 N MYBL2 n/a
2 TRCN0000297366 GCTAACAACAAAGTTCCACTT pLKO_005 2470 3UTR 100% 4.050 5.670 N MYBL2 n/a
3 TRCN0000020520 GCTTGGTGTGACCTGAGTAAA pLKO.1 1131 CDS 100% 13.200 10.560 N MYBL2 n/a
4 TRCN0000277963 GCTTGGTGTGACCTGAGTAAA pLKO_005 1131 CDS 100% 13.200 10.560 N MYBL2 n/a
5 TRCN0000020521 CCCAGATCAGAAGTACTCCAT pLKO.1 1685 CDS 100% 2.640 1.848 N MYBL2 n/a
6 TRCN0000278025 CCCAGATCAGAAGTACTCCAT pLKO_005 1685 CDS 100% 2.640 1.848 N MYBL2 n/a
7 TRCN0000020523 CTGGCTCTTGACATTGTGGAT pLKO.1 1926 CDS 100% 2.640 1.848 N MYBL2 n/a
8 TRCN0000278026 CTGGCTCTTGACATTGTGGAT pLKO_005 1926 CDS 100% 2.640 1.848 N MYBL2 n/a
9 TRCN0000020522 GACAGTATCAACAACAGCCTA pLKO.1 1182 CDS 100% 2.640 1.848 N MYBL2 n/a
10 TRCN0000297064 GACAGTATCAACAACAGCCTA pLKO_005 1182 CDS 100% 2.640 1.848 N MYBL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002466.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.