Transcript: Human NM_002508.3

Homo sapiens nidogen 1 (NID1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
NID1 (4811)
Length:
5792
CDS:
12..3755

Additional Resources:

NCBI RefSeq record:
NM_002508.3
NBCI Gene record:
NID1 (4811)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002508.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303937 CCTCCACTCTTACGTAGTAAT pLKO_005 1382 CDS 100% 13.200 18.480 N NID1 n/a
2 TRCN0000055450 GCAGTCTACGTCACCACAAAT pLKO.1 228 CDS 100% 13.200 18.480 N NID1 n/a
3 TRCN0000303953 TTCCCGAGACCGTTGGATATT pLKO_005 1438 CDS 100% 13.200 18.480 N NID1 n/a
4 TRCN0000055449 CCAGAGGCATTGTAACGGATT pLKO.1 3208 CDS 100% 4.050 5.670 N NID1 n/a
5 TRCN0000303879 TCCCGGCTAAAGTCATCATTG pLKO_005 2935 CDS 100% 10.800 7.560 N NID1 n/a
6 TRCN0000055451 CCAGAAGGTATCGCTGTTGAT pLKO.1 3078 CDS 100% 4.950 3.465 N NID1 n/a
7 TRCN0000055448 CCTCCCAGATAGAATGTCAAT pLKO.1 4415 3UTR 100% 4.950 3.465 N NID1 n/a
8 TRCN0000300121 CCTCCCAGATAGAATGTCAAT pLKO_005 4415 3UTR 100% 4.950 3.465 N NID1 n/a
9 TRCN0000055452 CCTCAGGTCATAGATGTGGAT pLKO.1 1104 CDS 100% 2.640 1.848 N NID1 n/a
10 TRCN0000303939 TTGCCTCCTGGGACCCATTTA pLKO_005 2829 CDS 100% 13.200 6.600 Y NID1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002508.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.