Transcript: Human NM_002583.4

Homo sapiens pro-apoptotic WT1 regulator (PAWR), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
PAWR (5074)
Length:
8991
CDS:
241..1263

Additional Resources:

NCBI RefSeq record:
NM_002583.4
NBCI Gene record:
PAWR (5074)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002583.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020306 GTAGATATTCTCGAACAGATA pLKO.1 956 CDS 100% 4.950 6.930 N PAWR n/a
2 TRCN0000344095 GTAGATATTCTCGAACAGATA pLKO_005 956 CDS 100% 4.950 6.930 N PAWR n/a
3 TRCN0000020305 GAACAGTTTCAGGCAGATATA pLKO.1 899 CDS 100% 13.200 9.240 N PAWR n/a
4 TRCN0000344094 GAACAGTTTCAGGCAGATATA pLKO_005 899 CDS 100% 13.200 9.240 N PAWR n/a
5 TRCN0000020307 CCTAAGACTTGTGAGACTGAT pLKO.1 1098 CDS 100% 4.950 3.465 N PAWR n/a
6 TRCN0000344096 CCTAAGACTTGTGAGACTGAT pLKO_005 1098 CDS 100% 4.950 3.465 N PAWR n/a
7 TRCN0000020304 CGCAGAGTGCTTAGATGAGTA pLKO.1 750 CDS 100% 4.950 3.465 N PAWR n/a
8 TRCN0000352973 CGCAGAGTGCTTAGATGAGTA pLKO_005 750 CDS 100% 4.950 3.465 N PAWR n/a
9 TRCN0000020308 GACCTAGATGACATAGAAGAT pLKO.1 1177 CDS 100% 4.950 3.465 N PAWR n/a
10 TRCN0000344100 GACCTAGATGACATAGAAGAT pLKO_005 1177 CDS 100% 4.950 3.465 N PAWR n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3390 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002583.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.