Transcript: Human NM_002605.3

Homo sapiens phosphodiesterase 8A (PDE8A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PDE8A (5151)
Length:
4036
CDS:
308..2797

Additional Resources:

NCBI RefSeq record:
NM_002605.3
NBCI Gene record:
PDE8A (5151)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002605.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048874 GCTAAGATCATGGTTACAAAT pLKO.1 1918 CDS 100% 13.200 18.480 N PDE8A n/a
2 TRCN0000301058 GCTAAGATCATGGTTACAAAT pLKO_005 1918 CDS 100% 13.200 18.480 N PDE8A n/a
3 TRCN0000048877 GCTGACTTGCTCGATACTATA pLKO.1 1115 CDS 100% 13.200 18.480 N PDE8A n/a
4 TRCN0000301063 GCTGACTTGCTCGATACTATA pLKO_005 1115 CDS 100% 13.200 18.480 N PDE8A n/a
5 TRCN0000048873 CCGGATACATTCCATGACAAT pLKO.1 1453 CDS 100% 4.950 3.960 N PDE8A n/a
6 TRCN0000301061 CCGGATACATTCCATGACAAT pLKO_005 1453 CDS 100% 4.950 3.960 N PDE8A n/a
7 TRCN0000048875 GCACGCATTTCGGAAGAATAT pLKO.1 2531 CDS 100% 13.200 9.240 N PDE8A n/a
8 TRCN0000301059 GCACGCATTTCGGAAGAATAT pLKO_005 2531 CDS 100% 13.200 9.240 N PDE8A n/a
9 TRCN0000048876 CCAAAGAAGATAACCAATGTA pLKO.1 567 CDS 100% 5.625 3.938 N PDE8A n/a
10 TRCN0000301145 CCAAAGAAGATAACCAATGTA pLKO_005 567 CDS 100% 5.625 3.938 N PDE8A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002605.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.