Transcript: Human NM_002629.4

Homo sapiens phosphoglycerate mutase 1 (PGAM1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PGAM1 (5223)
Length:
1802
CDS:
118..882

Additional Resources:

NCBI RefSeq record:
NM_002629.4
NBCI Gene record:
PGAM1 (5223)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002629.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330628 GAGAGTCTGAAGGATACTATT pLKO_005 577 CDS 100% 13.200 7.920 N PGAM1 n/a
2 TRCN0000049106 GTATTCCCATTGTCTATGAAT pLKO.1 755 CDS 100% 5.625 3.375 N PGAM1P8 n/a
3 TRCN0000330627 CCTTATCCAACAGAGTTTAAA pLKO_005 1130 3UTR 100% 15.000 7.500 Y PGAM1 n/a
4 TRCN0000353685 GGTCTAACCGGTCTCAATAAA pLKO_005 397 CDS 100% 15.000 7.500 Y PGAM1 n/a
5 TRCN0000049103 CCCTTATCCAACAGAGTTTAA pLKO.1 1129 3UTR 100% 13.200 6.600 Y PGAM1P8 n/a
6 TRCN0000029470 CCCTTCTGGAATGAAGAAATA pLKO.1 610 CDS 100% 13.200 6.600 Y PGAM1 n/a
7 TRCN0000330571 CCCTTCTGGAATGAAGAAATA pLKO_005 610 CDS 100% 13.200 6.600 Y PGAM1 n/a
8 TRCN0000149045 GCCCTTCTGGAATGAAGAAAT pLKO.1 609 CDS 100% 13.200 6.600 Y PGAM4 n/a
9 TRCN0000146992 CAAGAACTTGAAGCCTATCAA pLKO.1 780 CDS 100% 5.625 2.813 Y PGAM4 n/a
10 TRCN0000029471 CCATCCTTTCTACAGCAACAT pLKO.1 504 CDS 100% 4.950 2.475 Y PGAM1 n/a
11 TRCN0000330570 CCATCCTTTCTACAGCAACAT pLKO_005 504 CDS 100% 4.950 2.475 Y PGAM1 n/a
12 TRCN0000029469 CCGGTCTCAATAAAGCAGAAA pLKO.1 404 CDS 100% 4.950 2.475 Y PGAM1 n/a
13 TRCN0000029472 CCTGTGAGAGTCTGAAGGATA pLKO.1 572 CDS 100% 4.950 2.475 Y PGAM1 n/a
14 TRCN0000029473 CGCCTCAATGAGCGGCACTAT pLKO.1 373 CDS 100% 1.650 0.825 Y PGAM1 n/a
15 TRCN0000148872 CCTTGTTTCATGGCAGTGAAA pLKO.1 1628 3UTR 100% 0.495 0.248 Y PGAM4 n/a
16 TRCN0000115262 CCCTTCTGGAATGAAGAAATT pLKO.1 610 CDS 100% 13.200 6.600 Y Pgam1 n/a
17 TRCN0000319842 CCCTTCTGGAATGAAGAAATT pLKO_005 610 CDS 100% 13.200 6.600 Y Pgam1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002629.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.