Transcript: Human NM_002632.5

Homo sapiens placental growth factor (PGF), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
PGF (5228)
Length:
1911
CDS:
523..1035

Additional Resources:

NCBI RefSeq record:
NM_002632.5
NBCI Gene record:
PGF (5228)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002632.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058239 CGATGAGAATCTGCACTGTGT pLKO.1 786 CDS 100% 2.640 3.696 N PGF n/a
2 TRCN0000058240 CTCAGCACGTTCGCTGCGAAT pLKO.1 890 CDS 100% 1.350 1.080 N PGF n/a
3 TRCN0000308204 TCCTACGTGGAGCTGACGTTC pLKO_005 868 CDS 100% 1.350 1.080 N PGF n/a
4 TRCN0000058242 TGTCACCATGCAGCTCCTAAA pLKO.1 825 CDS 100% 10.800 7.560 N PGF n/a
5 TRCN0000296378 AGCACATGTTCAGCCCATCCT pLKO_005 731 CDS 100% 2.640 1.848 N PGF n/a
6 TRCN0000058238 TGCAGCTCCTAAAGATCCGTT pLKO.1 833 CDS 100% 2.640 1.848 N PGF n/a
7 TRCN0000289713 TGCAGCTCCTAAAGATCCGTT pLKO_005 833 CDS 100% 2.640 1.848 N PGF n/a
8 TRCN0000296380 TTCGGAGCTCCTGTCCAAAGT pLKO_005 1417 3UTR 100% 4.950 2.970 N PGF n/a
9 TRCN0000296379 AGAGAGAAGCAGAGACCCACA pLKO_005 976 CDS 100% 2.160 1.296 N PGF n/a
10 TRCN0000058241 GCCGGAAAGGAGGAGACCCAA pLKO.1 936 CDS 100% 0.000 0.000 N PGF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002632.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.