Transcript: Human NM_002688.6

Homo sapiens septin 5 (SEPTIN5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
SEPTIN5 (5413)
Length:
2031
CDS:
87..1196

Additional Resources:

NCBI RefSeq record:
NM_002688.6
NBCI Gene record:
SEPTIN5 (5413)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002688.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381331 CAGAGGACAAGCAGGACATTG pLKO_005 127 CDS 100% 10.800 7.560 N SEPTIN5 n/a
2 TRCN0000155333 GCAGGACATTGACAAGCAGTA pLKO.1 137 CDS 100% 4.050 2.835 N SEPTIN5 n/a
3 TRCN0000155973 CCAGCAGTTTGAGCAGTACTT pLKO.1 476 CDS 100% 4.950 2.475 Y SEPTIN5 n/a
4 TRCN0000382000 ATCGTGCCTCTCATCGCCAAA pLKO_005 636 CDS 100% 4.050 2.025 Y SEPTIN5 n/a
5 TRCN0000154293 GCTTATCAGGATGAAGGATGA pLKO.1 1115 CDS 100% 4.050 2.025 Y SEPTIN5 n/a
6 TRCN0000156099 CGGTGAAGAAAGGCTTTGACT pLKO.1 199 CDS 100% 3.000 1.500 Y SEPTIN5 n/a
7 TRCN0000155972 CCTGACAGACTTGTACAAGGA pLKO.1 281 CDS 100% 2.640 1.320 Y SEPTIN5 n/a
8 TRCN0000152556 GATTGACAAGTTTGGGATCCA pLKO.1 713 CDS 100% 2.640 1.320 Y SEPTIN5 n/a
9 TRCN0000155157 GCATGAGAAGGTCAACATCGT pLKO.1 620 CDS 100% 2.640 1.320 Y SEPTIN5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002688.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.