Transcript: Human NM_002726.5

Homo sapiens prolyl endopeptidase (PREP), mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
PREP (5550)
Length:
7250
CDS:
192..2324

Additional Resources:

NCBI RefSeq record:
NM_002726.5
NBCI Gene record:
PREP (5550)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002726.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050202 CCATGCTTGGACCACTGATTA pLKO.1 1967 CDS 100% 13.200 18.480 N PREP n/a
2 TRCN0000050198 CGCTATGTCTTGTTATCAATA pLKO.1 924 CDS 100% 13.200 18.480 N PREP n/a
3 TRCN0000288955 CGCTATGTCTTGTTATCAATA pLKO_005 924 CDS 100% 13.200 18.480 N PREP n/a
4 TRCN0000050199 CCCAACATACTGTCTGACGAT pLKO.1 537 CDS 100% 2.640 3.696 N PREP n/a
5 TRCN0000288956 CCCAACATACTGTCTGACGAT pLKO_005 537 CDS 100% 2.640 3.696 N PREP n/a
6 TRCN0000050200 CCTGACCTCTTTGGTTGTGTT pLKO.1 1893 CDS 100% 4.950 3.465 N PREP n/a
7 TRCN0000288957 CCTGACCTCTTTGGTTGTGTT pLKO_005 1893 CDS 100% 4.950 3.465 N PREP n/a
8 TRCN0000050201 CCAGCTTTCTTATATGGCTAT pLKO.1 1590 CDS 100% 4.050 2.835 N PREP n/a
9 TRCN0000288890 CCAGCTTTCTTATATGGCTAT pLKO_005 1590 CDS 100% 4.050 2.835 N PREP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002726.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.