Transcript: Human NM_002772.3

Homo sapiens transmembrane serine protease 15 (TMPRSS15), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
TMPRSS15 (5651)
Length:
4076
CDS:
164..3223

Additional Resources:

NCBI RefSeq record:
NM_002772.3
NBCI Gene record:
TMPRSS15 (5651)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002772.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002770 CCTTAGTTTCTGGTATCATAT pLKO.1 1429 CDS 100% 13.200 18.480 N TMPRSS15 n/a
2 TRCN0000195271 CTGATGCTCTAACGTGTATAA pLKO.1 738 CDS 100% 13.200 18.480 N TMPRSS15 n/a
3 TRCN0000194784 CGGTTGTATATCAAGGTACTA pLKO.1 2913 CDS 100% 4.950 6.930 N TMPRSS15 n/a
4 TRCN0000195005 CATCCGGAGTTACATATAATC pLKO.1 357 CDS 100% 13.200 10.560 N TMPRSS15 n/a
5 TRCN0000002769 CGAAGAAAGGACAACGACATT pLKO.1 2774 CDS 100% 4.950 3.960 N TMPRSS15 n/a
6 TRCN0000194727 CATTCAGTTCTACGAACTTTC pLKO.1 1770 CDS 100% 10.800 7.560 N TMPRSS15 n/a
7 TRCN0000196580 GCATATACCATACACTTAAGA pLKO.1 3546 3UTR 100% 5.625 3.938 N TMPRSS15 n/a
8 TRCN0000002773 CCAGGCTACTCATTATCCAAA pLKO.1 877 CDS 100% 4.950 3.465 N TMPRSS15 n/a
9 TRCN0000002771 CCTATTTGTTTACCGGAAGAA pLKO.1 2843 CDS 100% 4.950 3.465 N TMPRSS15 n/a
10 TRCN0000002772 CCATAGCAATACAGAATAACT pLKO.1 3401 3UTR 100% 5.625 3.375 N TMPRSS15 n/a
11 TRCN0000195239 CAGGTATTTCTTCACAGATCT pLKO.1 3460 3UTR 100% 4.950 2.970 N TMPRSS15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002772.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.