Transcript: Human NM_002865.3

Homo sapiens RAB2A, member RAS oncogene family (RAB2A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-28
Taxon:
Homo sapiens (human)
Gene:
RAB2A (5862)
Length:
3735
CDS:
222..860

Additional Resources:

NCBI RefSeq record:
NM_002865.3
NBCI Gene record:
RAB2A (5862)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002865.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322849 GCGACACAGGTGTTGGTAAAT pLKO_005 259 CDS 100% 13.200 18.480 N RAB2A n/a
2 TRCN0000322920 TCCATCACAAGGTCGTATTAC pLKO_005 429 CDS 100% 13.200 18.480 N RAB2A n/a
3 TRCN0000029199 GCTCGAATGATAACTATTGAT pLKO.1 354 CDS 100% 5.625 7.875 N RAB2A n/a
4 TRCN0000322847 GCTCGAATGATAACTATTGAT pLKO_005 354 CDS 100% 5.625 7.875 N RAB2A n/a
5 TRCN0000380686 GGGCCTACTCACTTATTCTTT pLKO_005 890 3UTR 100% 5.625 7.875 N RAB2A n/a
6 TRCN0000029200 CCAGTGCATGACCTTACTATT pLKO.1 318 CDS 100% 13.200 9.240 N RAB2A n/a
7 TRCN0000380346 ATGCTTATTGCTACAGTTTAC pLKO_005 281 CDS 100% 10.800 7.560 N RAB2A n/a
8 TRCN0000380427 ACGAGAACATGGACTCATCTT pLKO_005 635 CDS 100% 4.950 3.465 N RAB2A n/a
9 TRCN0000029201 CCAGCATTCCAATTCCAACAT pLKO.1 536 CDS 100% 4.950 3.465 N RAB2A n/a
10 TRCN0000029203 CGTTCCATCACAAGGTCGTAT pLKO.1 426 CDS 100% 4.950 3.465 N RAB2A n/a
11 TRCN0000029202 GCTGCTACCAATGCAACACAT pLKO.1 795 CDS 100% 4.950 3.465 N RAB2A n/a
12 TRCN0000322917 GCTGCTACCAATGCAACACAT pLKO_005 795 CDS 100% 4.950 3.465 N RAB2A n/a
13 TRCN0000322919 TATGTCACAGAAGACTTTAAT pLKO_005 962 3UTR 100% 15.000 9.000 N RAB2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002865.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.