Transcript: Human NM_002868.4

Homo sapiens RAB5B, member RAS oncogene family (RAB5B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
RAB5B (5869)
Length:
5273
CDS:
155..802

Additional Resources:

NCBI RefSeq record:
NM_002868.4
NBCI Gene record:
RAB5B (5869)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002868.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382019 CAATCGTGGTTTACGACATTA pLKO_005 441 CDS 100% 13.200 18.480 N RAB5B n/a
2 TRCN0000296414 GAAAGTCAAGCCTGGTATTAC pLKO_005 249 CDS 100% 13.200 18.480 N RAB5B n/a
3 TRCN0000048229 GCCAGTCCTAGCATCGTTATT pLKO.1 518 CDS 100% 13.200 18.480 N RAB5B n/a
4 TRCN0000289949 GCCAGTCCTAGCATCGTTATT pLKO_005 518 CDS 100% 13.200 18.480 N RAB5B n/a
5 TRCN0000296358 AGGTACAAGACAGCGACTTAC pLKO_005 1080 3UTR 100% 10.800 15.120 N RAB5B n/a
6 TRCN0000048228 CCAAGCTGCAATCGTGGTTTA pLKO.1 433 CDS 100% 10.800 15.120 N RAB5B n/a
7 TRCN0000048230 CCGTTTGTCTAGATGACACAA pLKO.1 336 CDS 100% 4.950 3.960 N RAB5B n/a
8 TRCN0000381110 ATTGGTCCTGCTGGGAGAATC pLKO_005 220 CDS 100% 10.800 7.560 N RAB5B n/a
9 TRCN0000381789 AGGAGCGATATCACAGCTTAG pLKO_005 390 CDS 100% 6.000 4.200 N RAB5B n/a
10 TRCN0000308221 GACCTGGCCAACAAACGTATG pLKO_005 560 CDS 100% 6.000 4.200 N RAB5B n/a
11 TRCN0000048231 ACAGCTATGAACGTGAATGAT pLKO.1 650 CDS 100% 5.625 3.938 N RAB5B n/a
12 TRCN0000382167 CAAAGGGCAGTTCCATGAGTA pLKO_005 277 CDS 100% 4.950 3.465 N RAB5B n/a
13 TRCN0000296415 GCAGATGACAACAGCTTATTG pLKO_005 608 CDS 100% 13.200 7.920 N RAB5B n/a
14 TRCN0000048232 CCGAGCAAAGACATGGGTGAA pLKO.1 481 CDS 100% 4.050 2.430 N RAB5B n/a
15 TRCN0000382479 AGGAGGTTTCCAGTTCATTTA pLKO_005 1258 3UTR 100% 13.200 6.600 Y RAB5B n/a
16 TRCN0000100620 GCACTTTAATTGATGGTAGTT pLKO.1 1766 3UTR 100% 4.950 2.475 Y Rab5b n/a
17 TRCN0000325390 GCACTTTAATTGATGGTAGTT pLKO_005 1766 3UTR 100% 4.950 2.475 Y Rab5b n/a
18 TRCN0000100623 GCAGATGACAACAGCTTATTA pLKO.1 608 CDS 100% 15.000 9.000 N Rab5b n/a
19 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3936 3UTR 100% 5.625 2.813 Y KLHL30 n/a
20 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3936 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002868.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.