Transcript: Human NM_002915.4

Homo sapiens replication factor C subunit 3 (RFC3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
RFC3 (5983)
Length:
2306
CDS:
31..1101

Additional Resources:

NCBI RefSeq record:
NM_002915.4
NBCI Gene record:
RFC3 (5983)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002915.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000331068 ATAGTGACCGAGTAGTCATTC pLKO_005 335 CDS 100% 10.800 15.120 N RFC3 n/a
2 TRCN0000331080 ATTAGCACCATTGCAAGTAAC pLKO_005 280 CDS 100% 10.800 15.120 N RFC3 n/a
3 TRCN0000072652 GTGCTGCAATTCTACATCTAA pLKO.1 519 CDS 100% 5.625 7.875 N RFC3 n/a
4 TRCN0000330990 AGCCTGCAGAGTGCAACAATA pLKO_005 723 CDS 100% 13.200 9.240 N RFC3 n/a
5 TRCN0000330991 AGATATTTGCCACGTGTTATC pLKO_005 600 CDS 100% 10.800 7.560 N RFC3 n/a
6 TRCN0000072649 GCAAGTAACTACCACCTTGAA pLKO.1 292 CDS 100% 4.950 3.465 N RFC3 n/a
7 TRCN0000072650 GCTGGAAATAGTGACCGAGTA pLKO.1 328 CDS 100% 4.050 2.835 N RFC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002915.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.