Transcript: Human NM_003044.5

Homo sapiens solute carrier family 6 member 12 (SLC6A12), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
SLC6A12 (6539)
Length:
3751
CDS:
920..2764

Additional Resources:

NCBI RefSeq record:
NM_003044.5
NBCI Gene record:
SLC6A12 (6539)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003044.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038295 CCGTACCTGATGCTTGTCATT pLKO.1 1655 CDS 100% 4.950 6.930 N SLC6A12 n/a
2 TRCN0000038294 CGAGTCATATTTGAATGTCTA pLKO.1 1294 CDS 100% 4.950 6.930 N SLC6A12 n/a
3 TRCN0000038297 GCCAGATTTGTTCCGCCTCAA pLKO.1 1735 CDS 100% 4.050 5.670 N SLC6A12 n/a
4 TRCN0000437538 GTTGGATCGGAGGTTCCGTTA pLKO_005 3223 3UTR 100% 4.050 5.670 N SLC6A12 n/a
5 TRCN0000038298 CGCCGTCATGTGCTACCTGAT pLKO.1 2203 CDS 100% 1.350 1.890 N SLC6A12 n/a
6 TRCN0000426858 ATTCTGGGAGAGACGAGTTCT pLKO_005 1489 CDS 100% 4.950 3.465 N SLC6A12 n/a
7 TRCN0000038296 GTCTGCATAAGCTGGGTGTAT pLKO.1 2327 CDS 100% 4.950 3.465 N SLC6A12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003044.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.