Transcript: Human NM_003062.4

Homo sapiens slit guidance ligand 3 (SLIT3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
SLIT3 (6586)
Length:
9716
CDS:
431..5002

Additional Resources:

NCBI RefSeq record:
NM_003062.4
NBCI Gene record:
SLIT3 (6586)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003062.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000443926 AGCTATGCGACGAGGTGATTG pLKO_005 3516 CDS 100% 10.800 15.120 N SLIT3 n/a
2 TRCN0000432623 AGAATCAGATATCGGATATTG pLKO_005 1449 CDS 100% 13.200 10.560 N SLIT3 n/a
3 TRCN0000053413 CCAGACTAGATTTGAGTGAAA pLKO.1 837 CDS 100% 4.950 3.960 N SLIT3 n/a
4 TRCN0000053415 CGTGCAAGAATAACGGGACAT pLKO.1 3201 CDS 100% 4.050 3.240 N SLIT3 n/a
5 TRCN0000425890 GACTGCGCCTGAACAAGAATA pLKO_005 768 CDS 100% 13.200 9.240 N SLIT3 n/a
6 TRCN0000053416 CCTAGAACAGAACTCCATCAA pLKO.1 1369 CDS 100% 4.950 3.465 N SLIT3 n/a
7 TRCN0000053417 GACCAATTACACCTTCAGTAA pLKO.1 2800 CDS 100% 4.950 3.465 N SLIT3 n/a
8 TRCN0000053414 CGACTGAATGACAATGAGGTA pLKO.1 2042 CDS 100% 2.640 1.848 N SLIT3 n/a
9 TRCN0000437807 CTCCGACACCTGACGCTTATT pLKO_005 2750 CDS 100% 13.200 7.920 N SLIT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003062.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.