Transcript: Human NM_003098.3

Homo sapiens syntrophin alpha 1 (SNTA1), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
SNTA1 (6640)
Length:
2211
CDS:
144..1661

Additional Resources:

NCBI RefSeq record:
NM_003098.3
NBCI Gene record:
SNTA1 (6640)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003098.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053450 TCAAGCAGATTGGCTGGCTAA pLKO.1 1024 CDS 100% 4.050 3.240 N SNTA1 n/a
2 TRCN0000366922 ACAAGATGCCTATTCTCATTT pLKO_005 466 CDS 100% 13.200 9.240 N Snta1 n/a
3 TRCN0000053452 GCTGGAGGTCAAGTATATGAA pLKO.1 632 CDS 100% 5.625 3.938 N SNTA1 n/a
4 TRCN0000300043 GCTGGAGGTCAAGTATATGAA pLKO_005 632 CDS 100% 5.625 3.938 N SNTA1 n/a
5 TRCN0000053449 CACCGTATTTCAAGAACTCTA pLKO.1 661 CDS 100% 4.950 3.465 N SNTA1 n/a
6 TRCN0000300107 CACCGTATTTCAAGAACTCTA pLKO_005 661 CDS 100% 4.950 3.465 N SNTA1 n/a
7 TRCN0000053448 GCCTATTCTCATTTCCAAGAT pLKO.1 473 CDS 100% 4.950 3.465 N SNTA1 n/a
8 TRCN0000300042 GCCTATTCTCATTTCCAAGAT pLKO_005 473 CDS 100% 4.950 3.465 N SNTA1 n/a
9 TRCN0000053451 CCGGGAGAACAAGATGCCTAT pLKO.1 458 CDS 100% 4.050 2.835 N SNTA1 n/a
10 TRCN0000300044 CCGGGAGAACAAGATGCCTAT pLKO_005 458 CDS 100% 4.050 2.835 N SNTA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003098.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.