Transcript: Human NM_003102.4

Homo sapiens superoxide dismutase 3 (SOD3), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
SOD3 (6649)
Length:
1416
CDS:
96..818

Additional Resources:

NCBI RefSeq record:
NM_003102.4
NBCI Gene record:
SOD3 (6649)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003102.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000441480 GGCCTCCATTTGTACCGAAAC pLKO_005 1045 3UTR 100% 6.000 8.400 N SOD3 n/a
2 TRCN0000049074 GATCCGAGACATGTACGCCAA pLKO.1 197 CDS 100% 2.160 3.024 N SOD3 n/a
3 TRCN0000049075 CGACGCCTTCTTCGCCCTGGA pLKO.1 374 CDS 100% 0.000 0.000 N SOD3 n/a
4 TRCN0000049077 CGACTTCGGCAACTTCGCGGT pLKO.1 527 CDS 100% 0.000 0.000 N SOD3 n/a
5 TRCN0000438449 TGAGGTCTCACCTTCGCCTTT pLKO_005 909 3UTR 100% 4.050 2.835 N SOD3 n/a
6 TRCN0000426257 GAGCACTCAGAGCGCAAGAAG pLKO_005 765 CDS 100% 1.650 1.155 N SOD3 n/a
7 TRCN0000049073 GTCGTCCTCTTCCGGCAGCTT pLKO.1 336 CDS 100% 0.000 0.000 N SOD3 n/a
8 TRCN0000435980 AGATCTGGCAGGAGGTCATGC pLKO_005 226 CDS 100% 1.350 0.810 N SOD3 n/a
9 TRCN0000049076 GCCCAACTCTGACTCGGCGGA pLKO.1 173 CDS 100% 0.000 0.000 N SOD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003102.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.