Transcript: Human NM_003281.4

Homo sapiens troponin I1, slow skeletal type (TNNI1), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
TNNI1 (7135)
Length:
6110
CDS:
78..641

Additional Resources:

NCBI RefSeq record:
NM_003281.4
NBCI Gene record:
TNNI1 (7135)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003281.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435500 CATCACACCTTCTTCATTAAA pLKO_005 994 3UTR 100% 15.000 10.500 N TNNI1 n/a
2 TRCN0000419967 ATACGACATTGAGGCCAAATG pLKO_005 317 CDS 100% 10.800 7.560 N TNNI1 n/a
3 TRCN0000161772 CAAGTCTGTGAAGAAGGAAGA pLKO.1 503 CDS 100% 4.050 2.835 N TNNI1 n/a
4 TRCN0000161904 GATTAAGGACCTGAAGCTGAA pLKO.1 356 CDS 100% 4.050 2.835 N TNNI1 n/a
5 TRCN0000164326 CAAGTCTCCGACCTCACAATA pLKO.1 620 CDS 100% 13.200 7.920 N TNNI1 n/a
6 TRCN0000161465 GAAGAAGGAAGACACAGAGAA pLKO.1 512 CDS 100% 4.950 2.970 N TNNI1 n/a
7 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 2018 3UTR 100% 4.950 2.475 Y n/a
8 TRCN0000163448 GCCGGAAGAAGATGTTTGATG pLKO.1 595 CDS 100% 4.950 2.475 Y TNNI1 n/a
9 TRCN0000116227 CCTCCCAAAGTTCTGGGATTA pLKO.1 2086 3UTR 100% 1.080 0.540 Y ELOVL7 n/a
10 TRCN0000164591 CCTCCCAAAGTTCTGGGATTA pLKO.1 2086 3UTR 100% 1.080 0.540 Y TNNI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003281.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.