Transcript: Human NM_003316.4

Homo sapiens tetratricopeptide repeat domain 3 (TTC3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
TTC3 (7267)
Length:
9018
CDS:
1397..7474

Additional Resources:

NCBI RefSeq record:
NM_003316.4
NBCI Gene record:
TTC3 (7267)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003316.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320542 GAGTTTATCAGCACCTATATT pLKO_005 2521 CDS 100% 15.000 21.000 N TTC3 n/a
2 TRCN0000368912 TATTCCTGATATGCCTATATT pLKO_005 7921 3UTR 100% 15.000 21.000 N TTC3 n/a
3 TRCN0000010840 GCGGATGAGGCGTTGAAGGTA pLKO.1 2633 CDS 100% 1.000 1.400 N TTC3 n/a
4 TRCN0000320545 ATTGCCAACAGTGGCTAATAA pLKO_005 7660 3UTR 100% 15.000 10.500 N TTC3 n/a
5 TRCN0000368911 AGATCTCAAAGACGGAATTAG pLKO_005 6012 CDS 100% 13.200 9.240 N TTC3 n/a
6 TRCN0000368982 GACCAACACAGTAACGAATAT pLKO_005 4649 CDS 100% 13.200 9.240 N TTC3 n/a
7 TRCN0000003992 GCTCTTTGGGAATATCTGTAA pLKO.1 5622 CDS 100% 4.950 3.465 N TTC3 n/a
8 TRCN0000003993 AGGAATTATCTGAAGCCGAAA pLKO.1 3054 CDS 100% 4.050 2.835 N TTC3 n/a
9 TRCN0000003995 GAGTTTATGAGCTGATTTGGT pLKO.1 8686 3UTR 100% 3.000 2.100 N TTC3 n/a
10 TRCN0000003994 GAGGAATTATCTGAAGCCGAA pLKO.1 3053 CDS 100% 2.160 1.512 N TTC3 n/a
11 TRCN0000350261 CCCAGTACACCAGCATATATA pLKO_005 5424 CDS 100% 15.000 7.500 Y TTC3 n/a
12 TRCN0000320611 GTCAATACTGAGCCATATAAT pLKO_005 5825 CDS 100% 15.000 7.500 Y TTC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003316.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.