Transcript: Human NM_003320.4

Homo sapiens TUB bipartite transcription factor (TUB), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
TUB (7275)
Length:
6432
CDS:
242..1927

Additional Resources:

NCBI RefSeq record:
NM_003320.4
NBCI Gene record:
TUB (7275)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003320.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150142 GCAGGACATTTACCTCTTAAA pLKO.1 5270 3UTR 100% 13.200 9.240 N TUB n/a
2 TRCN0000148101 GAATAAGAACACGGAGAGTAT pLKO.1 1651 CDS 100% 4.950 3.465 N TUB n/a
3 TRCN0000150265 GCATTTGATTTCTCCAGGTTT pLKO.1 2594 3UTR 100% 4.950 3.465 N TUB n/a
4 TRCN0000148950 CGCATTTGATTTCTCCAGGTT pLKO.1 2593 3UTR 100% 2.640 1.848 N TUB n/a
5 TRCN0000149281 GAATGATGACACACAGTCCTA pLKO.1 1702 CDS 100% 2.640 1.848 N TUB n/a
6 TRCN0000034506 CCAGGCATGAACATGGTTCAT pLKO.1 1574 CDS 100% 0.495 0.347 N Tub n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003320.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.