Transcript: Human NM_003325.4

Homo sapiens histone cell cycle regulator (HIRA), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
HIRA (7290)
Length:
4053
CDS:
258..3311

Additional Resources:

NCBI RefSeq record:
NM_003325.4
NBCI Gene record:
HIRA (7290)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003325.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232160 ATCCGGAAGCGTTAGGTATTA pLKO_005 3697 3UTR 100% 13.200 18.480 N HIRA n/a
2 TRCN0000232158 TCAGGACCGTTAGCCATAATC pLKO_005 2904 CDS 100% 13.200 18.480 N HIRA n/a
3 TRCN0000020515 CGTGGATAACACTGTCGTCAT pLKO.1 707 CDS 100% 4.050 5.670 N HIRA n/a
4 TRCN0000020517 GCTTGGTCAAAGGGTTGACAT pLKO.1 781 CDS 100% 0.495 0.693 N HIRA n/a
5 TRCN0000232156 CTCTATCCTCCGGAATCATTC pLKO_005 629 CDS 100% 10.800 8.640 N HIRA n/a
6 TRCN0000020514 GCAGTGACGATTGAGCCATTT pLKO.1 3666 3UTR 100% 10.800 8.640 N HIRA n/a
7 TRCN0000232157 ACAAATCCATCATGGATATTT pLKO_005 1240 CDS 100% 15.000 10.500 N HIRA n/a
8 TRCN0000020516 GCAGGCGATTCTGTCAATAAA pLKO.1 1845 CDS 100% 15.000 10.500 N HIRA n/a
9 TRCN0000232159 TGAATACCGACTTCGAGAAAT pLKO_005 3110 CDS 100% 13.200 9.240 N HIRA n/a
10 TRCN0000020518 CGAGAAATATGCAAGGACTTA pLKO.1 3123 CDS 100% 4.950 3.465 N HIRA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003325.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.