Transcript: Human NM_003371.4

Homo sapiens vav guanine nucleotide exchange factor 2 (VAV2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
VAV2 (7410)
Length:
4734
CDS:
47..2566

Additional Resources:

NCBI RefSeq record:
NM_003371.4
NBCI Gene record:
VAV2 (7410)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003371.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048223 GCCACGATAAATTTGGATTAA pLKO.1 291 CDS 100% 13.200 18.480 N VAV2 n/a
2 TRCN0000418821 ACAGCATCGCGCAGAACAAAG pLKO_005 399 CDS 100% 10.800 15.120 N VAV2 n/a
3 TRCN0000423931 GTGGACAAGACTCGCAGATTT pLKO_005 2577 3UTR 100% 13.200 10.560 N VAV2 n/a
4 TRCN0000048226 CCCGAGATATGAGGGAGCTTT pLKO.1 2415 CDS 100% 4.950 3.960 N VAV2 n/a
5 TRCN0000048227 CAAGTGAAACTGGAGGAATTT pLKO.1 1220 CDS 100% 13.200 9.240 N VAV2 n/a
6 TRCN0000436728 CCATGCAGAGGGTGCTCAAAT pLKO_005 1026 CDS 100% 13.200 9.240 N VAV2 n/a
7 TRCN0000435647 CAATAAGCATCAAGTTCAATG pLKO_005 2139 CDS 100% 10.800 7.560 N VAV2 n/a
8 TRCN0000419630 TGGGTATGCTATTGTACATAG pLKO_005 2763 3UTR 100% 10.800 7.560 N VAV2 n/a
9 TRCN0000426913 CAAGGTCTTCCTCGATTTCAA pLKO_005 841 CDS 100% 5.625 3.938 N VAV2 n/a
10 TRCN0000048225 GCGAGACTTTGGAAAGGTCAT pLKO.1 352 CDS 100% 4.050 2.835 N VAV2 n/a
11 TRCN0000048224 GACAGGTACTTGTTCCTGTTT pLKO.1 1301 CDS 100% 0.495 0.347 N VAV2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003371.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.