Transcript: Human NM_003393.4

Homo sapiens Wnt family member 8B (WNT8B), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
WNT8B (7479)
Length:
2144
CDS:
161..1216

Additional Resources:

NCBI RefSeq record:
NM_003393.4
NBCI Gene record:
WNT8B (7479)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003393.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423403 AGGCGATTTCCAAGCAGTTTG pLKO_005 579 CDS 100% 10.800 15.120 N WNT8B n/a
2 TRCN0000432264 CCAATCGGGAGACAGCATTTG pLKO_005 402 CDS 100% 10.800 15.120 N WNT8B n/a
3 TRCN0000062095 CCTGATTTACTCCAGCAGTGT pLKO.1 268 CDS 100% 2.640 2.112 N WNT8B n/a
4 TRCN0000429574 ACAGCTGGTCGGTGAACAATT pLKO_005 222 CDS 100% 13.200 9.240 N WNT8B n/a
5 TRCN0000432977 AGGACCCAGGTAAAGTCAAAG pLKO_005 1575 3UTR 100% 10.800 7.560 N WNT8B n/a
6 TRCN0000062094 CCCAGAGTGGTATTGAAGAAT pLKO.1 300 CDS 100% 5.625 3.938 N WNT8B n/a
7 TRCN0000062097 CCCGGACTACTGCCTGGAGAA pLKO.1 916 CDS 100% 0.000 0.000 N WNT8B n/a
8 TRCN0000431555 AGAGGGAGAGACTGCAATTTC pLKO_005 1329 3UTR 100% 13.200 7.920 N WNT8B n/a
9 TRCN0000062096 GCACCATGAAACGCACGTGTA pLKO.1 681 CDS 100% 4.050 5.670 N WNT8B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003393.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.