Transcript: Human NM_003584.2

Homo sapiens dual specificity phosphatase 11 (DUSP11), mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
DUSP11 (8446)
Length:
1639
CDS:
43..1176

Additional Resources:

NCBI RefSeq record:
NM_003584.2
NBCI Gene record:
DUSP11 (8446)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003584.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314813 ACATATACTCAACGCTATTAT pLKO_005 463 CDS 100% 15.000 21.000 N DUSP11 n/a
2 TRCN0000314812 CCCTTATGTATTCAAGCTTAA pLKO_005 1278 3UTR 100% 10.800 15.120 N DUSP11 n/a
3 TRCN0000081481 ACTCGTTTCATTGCTTTCAAA pLKO.1 325 CDS 100% 5.625 4.500 N Dusp11 n/a
4 TRCN0000314765 CTACCTCATTTGCAGATATTT pLKO_005 663 CDS 100% 15.000 10.500 N DUSP11 n/a
5 TRCN0000380277 GAACTTCCCTTGCAAATTATT pLKO_005 1431 3UTR 100% 15.000 10.500 N DUSP11 n/a
6 TRCN0000002928 GCTACCTCATTTGCAGATATT pLKO.1 662 CDS 100% 13.200 9.240 N DUSP11 n/a
7 TRCN0000379845 TAAATTCAAACACGCTGTTAA pLKO_005 567 CDS 100% 13.200 9.240 N DUSP11 n/a
8 TRCN0000002932 GACTCGTTTCATTGCTTTCAA pLKO.1 324 CDS 100% 5.625 3.938 N DUSP11 n/a
9 TRCN0000314810 GACTCGTTTCATTGCTTTCAA pLKO_005 324 CDS 100% 5.625 3.938 N DUSP11 n/a
10 TRCN0000002930 CCTATCAGAAAGAATTGGAAT pLKO.1 790 CDS 100% 4.950 3.465 N DUSP11 n/a
11 TRCN0000314764 CCTATCAGAAAGAATTGGAAT pLKO_005 790 CDS 100% 4.950 3.465 N DUSP11 n/a
12 TRCN0000002931 GACTATTCACACAGGAGGTAT pLKO.1 1045 CDS 100% 4.950 3.465 N DUSP11 n/a
13 TRCN0000002929 GCTGTTTACCTCTTTGCTGAT pLKO.1 1313 3UTR 100% 4.050 2.430 N DUSP11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003584.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.