Transcript: Human NM_003613.4

Homo sapiens cartilage intermediate layer protein (CILP), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CILP (8483)
Length:
5678
CDS:
153..3707

Additional Resources:

NCBI RefSeq record:
NM_003613.4
NBCI Gene record:
CILP (8483)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003613.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248564 CATGAGGATCCACGGGTTAAA pLKO_005 2742 CDS 100% 13.200 18.480 N Cilp n/a
2 TRCN0000355633 CATGAGGATCCACGGGTTAAA pLKO_005 2742 CDS 100% 13.200 18.480 N CILP n/a
3 TRCN0000378030 ACGCCATTCGCTTCTACTATG pLKO_005 376 CDS 100% 10.800 15.120 N CILP n/a
4 TRCN0000002935 CCGTGATTAACCTGGAGCCTA pLKO.1 2479 CDS 100% 2.640 3.696 N CILP n/a
5 TRCN0000417064 CAAACTGTCACTTGGTTAATT pLKO_005 3772 3UTR 100% 15.000 12.000 N CILP n/a
6 TRCN0000002936 CGTGAATTTGCTTGTTTGTTT pLKO.1 3809 3UTR 100% 5.625 4.500 N CILP n/a
7 TRCN0000422163 AGTGGAGTCTTCTCCTAAATT pLKO_005 2657 CDS 100% 15.000 10.500 N CILP n/a
8 TRCN0000355522 AGTTCCTGAGAGCTATCTTAT pLKO_005 1364 CDS 100% 13.200 9.240 N CILP n/a
9 TRCN0000355521 GCCCAGGCCAGACAAGTATTT pLKO_005 1157 CDS 100% 13.200 9.240 N CILP n/a
10 TRCN0000002933 GCCACCAACTCCTTCTACTAT pLKO.1 1413 CDS 100% 5.625 3.938 N CILP n/a
11 TRCN0000002934 GAAGATCACAAAGGTCAAGTT pLKO.1 977 CDS 100% 4.950 3.465 N CILP n/a
12 TRCN0000002937 GCCCTATCTCAACAAGCTCAA pLKO.1 2705 CDS 100% 4.050 2.835 N CILP n/a
13 TRCN0000412291 GTCACCTCAGAGCCACTTAAT pLKO_005 2154 CDS 100% 13.200 7.920 N CILP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003613.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.