Transcript: Human NM_003619.4

Homo sapiens serine protease 12 (PRSS12), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PRSS12 (8492)
Length:
4809
CDS:
284..2911

Additional Resources:

NCBI RefSeq record:
NM_003619.4
NBCI Gene record:
PRSS12 (8492)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003619.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294459 GACATAGCCCTGGTTAGATTA pLKO_005 2459 CDS 100% 13.200 18.480 N PRSS12 n/a
2 TRCN0000050981 CGAGCCTATTCAAGAACACTA pLKO.1 2606 CDS 100% 4.950 6.930 N PRSS12 n/a
3 TRCN0000050980 GCTGACTGTATCAAGCAAGAT pLKO.1 2012 CDS 100% 4.950 6.930 N PRSS12 n/a
4 TRCN0000287073 GCTGACTGTATCAAGCAAGAT pLKO_005 2012 CDS 100% 4.950 6.930 N PRSS12 n/a
5 TRCN0000294460 ACACTCATGAGTGGCATATTT pLKO_005 3315 3UTR 100% 15.000 10.500 N PRSS12 n/a
6 TRCN0000294461 AGCATGGCATCAGGCATATTT pLKO_005 1267 CDS 100% 15.000 10.500 N PRSS12 n/a
7 TRCN0000050979 GCACACTGTTTCAAGAGGTAT pLKO.1 2306 CDS 100% 4.950 3.465 N PRSS12 n/a
8 TRCN0000050978 CGGCTTTGATTCTGTCCTCAA pLKO.1 340 CDS 100% 4.050 2.835 N PRSS12 n/a
9 TRCN0000287074 CGGCTTTGATTCTGTCCTCAA pLKO_005 340 CDS 100% 4.050 2.835 N PRSS12 n/a
10 TRCN0000050982 GCACAGTGGAAGTATATGCAA pLKO.1 825 CDS 100% 3.000 2.100 N PRSS12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003619.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.