Transcript: Human NM_003640.5

Homo sapiens elongator complex protein 1 (ELP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
ELP1 (8518)
Length:
5913
CDS:
317..4315

Additional Resources:

NCBI RefSeq record:
NM_003640.5
NBCI Gene record:
ELP1 (8518)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003640.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236372 AGGGATCCTGACGGGAATAAA pLKO_005 2741 CDS 100% 15.000 21.000 N ELP1 n/a
2 TRCN0000037869 GCGTCAAATATCACGTCATTT pLKO.1 2228 CDS 100% 13.200 18.480 N ELP1 n/a
3 TRCN0000218403 ACATTGAGGTTGCGTCAAATA pLKO_005 2217 CDS 100% 13.200 10.560 N ELP1 n/a
4 TRCN0000236371 GTCACCTTCTCTGGCTATTAA pLKO_005 2068 CDS 100% 15.000 10.500 N ELP1 n/a
5 TRCN0000236370 TCGCCACAAGAAACGTTTATT pLKO_005 3712 CDS 100% 15.000 10.500 N ELP1 n/a
6 TRCN0000037870 CCCAAAGAATATCTTCCATTT pLKO.1 3056 CDS 100% 10.800 7.560 N ELP1 n/a
7 TRCN0000037871 CGGTTCTAGGTCCCAATTCTA pLKO.1 4170 CDS 100% 5.625 3.938 N ELP1 n/a
8 TRCN0000037873 GCTGTGCTCTTGCTGTTAGAA pLKO.1 3551 CDS 100% 5.625 3.938 N ELP1 n/a
9 TRCN0000037872 GCCAGATATTTAAGTACCTTT pLKO.1 2043 CDS 100% 4.950 3.465 N ELP1 n/a
10 TRCN0000218255 TCCTTTGCTGACAGCTATTAT pLKO_005 4803 3UTR 100% 15.000 9.000 N ELP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003640.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.