Transcript: Human NM_003658.5

Homo sapiens BARX homeobox 2 (BARX2), mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
BARX2 (8538)
Length:
1905
CDS:
189..1028

Additional Resources:

NCBI RefSeq record:
NM_003658.5
NBCI Gene record:
BARX2 (8538)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003658.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013233 GCAAGCATTTGACAAAGACTT pLKO.1 1187 3UTR 100% 4.950 6.930 N BARX2 n/a
2 TRCN0000013235 GCGCTACAAGACTTTCATGAT pLKO.1 248 CDS 100% 4.950 6.930 N BARX2 n/a
3 TRCN0000415090 ATATCCGCTCCTCTCGGTGAT pLKO_005 395 CDS 100% 4.050 5.670 N BARX2 n/a
4 TRCN0000013237 TGTGAAGCACAGGAACCGAAA pLKO.1 918 CDS 100% 4.050 5.670 N BARX2 n/a
5 TRCN0000423374 CTATGTTGCAAGCCCTATATC pLKO_005 1326 3UTR 100% 13.200 9.240 N BARX2 n/a
6 TRCN0000013234 GCGATTACTTTGAGAAACTTT pLKO.1 295 CDS 100% 5.625 3.938 N BARX2 n/a
7 TRCN0000013236 CGCAGGATGAAATGGAAGAAA pLKO.1 738 CDS 100% 5.625 3.375 N BARX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003658.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.