Transcript: Human NM_003662.3

Homo sapiens pirin (PIR), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
PIR (8544)
Length:
1576
CDS:
486..1358

Additional Resources:

NCBI RefSeq record:
NM_003662.3
NBCI Gene record:
PIR (8544)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003662.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275003 TCTTGATGTGTCCTAGAATTT pLKO_005 1378 3UTR 100% 13.200 10.560 N PIR n/a
2 TRCN0000019255 CCATTTGTGATGAACACCAAT pLKO.1 1248 CDS 100% 4.950 3.465 N PIR n/a
3 TRCN0000274932 CCATTTGTGATGAACACCAAT pLKO_005 1248 CDS 100% 4.950 3.465 N PIR n/a
4 TRCN0000274933 ACTCGCACACCAACCTTATAT pLKO_005 978 CDS 100% 15.000 7.500 Y PIR n/a
5 TRCN0000019254 CCTACAACTGTGGGTTAATTT pLKO.1 824 CDS 100% 15.000 7.500 Y PIR n/a
6 TRCN0000274935 CCTACAACTGTGGGTTAATTT pLKO_005 824 CDS 100% 15.000 7.500 Y PIR n/a
7 TRCN0000019257 GCCATTAAGAGAACCAGTTAT pLKO.1 1217 CDS 100% 13.200 6.600 Y PIR n/a
8 TRCN0000274934 GCCATTAAGAGAACCAGTTAT pLKO_005 1217 CDS 100% 13.200 6.600 Y PIR n/a
9 TRCN0000019256 CTGGGAATAAAGTCCAAGGTT pLKO.1 954 CDS 100% 3.000 1.500 Y PIR n/a
10 TRCN0000019258 CCAGGAGGATTTCCTGATCAT pLKO.1 633 CDS 100% 0.495 0.248 Y PIR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003662.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.