Transcript: Human NM_003685.3

Homo sapiens KH-type splicing regulatory protein (KHSRP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
KHSRP (8570)
Length:
3256
CDS:
111..2246

Additional Resources:

NCBI RefSeq record:
NM_003685.3
NBCI Gene record:
KHSRP (8570)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003685.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013254 CCCGAGAAGATTGCTCATATA pLKO.1 1206 CDS 100% 13.200 18.480 N KHSRP n/a
2 TRCN0000277996 CCCGAGAAGATTGCTCATATA pLKO_005 1206 CDS 100% 13.200 18.480 N KHSRP n/a
3 TRCN0000013255 CGCCTACTACTCACACTACTA pLKO.1 1841 CDS 100% 4.950 3.960 N KHSRP n/a
4 TRCN0000297131 CGCCTACTACTCACACTACTA pLKO_005 1841 CDS 100% 4.950 3.960 N KHSRP n/a
5 TRCN0000013253 CTGAGGATAAAGCAATTCATT pLKO.1 2639 3UTR 100% 5.625 3.938 N KHSRP n/a
6 TRCN0000013257 GCTGGAGTGAAGATGATCTTA pLKO.1 897 CDS 100% 5.625 3.938 N KHSRP n/a
7 TRCN0000297073 GCTGGAGTGAAGATGATCTTA pLKO_005 897 CDS 100% 5.625 3.938 N KHSRP n/a
8 TRCN0000013256 GACTTCAATGACAGAAGAGTA pLKO.1 536 CDS 100% 4.950 3.465 N KHSRP n/a
9 TRCN0000278054 GACTTCAATGACAGAAGAGTA pLKO_005 536 CDS 100% 4.950 3.465 N KHSRP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003685.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.