Transcript: Human NM_003737.4

Homo sapiens dachsous cadherin-related 1 (DCHS1), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
DCHS1 (8642)
Length:
10713
CDS:
368..10264

Additional Resources:

NCBI RefSeq record:
NM_003737.4
NBCI Gene record:
DCHS1 (8642)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003737.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055951 GCTCGACATCAGCTTGTAGTA pLKO.1 8378 CDS 100% 4.950 6.930 N DCHS1 n/a
2 TRCN0000055950 CCTGACCTCAACCTGCTATTA pLKO.1 9158 CDS 100% 13.200 10.560 N DCHS1 n/a
3 TRCN0000055949 CCACCCATATTTGAGCAACTA pLKO.1 2726 CDS 100% 4.950 3.465 N DCHS1 n/a
4 TRCN0000055952 CGTCACTGATGTCAACGACAA pLKO.1 1750 CDS 100% 4.050 2.835 N DCHS1 n/a
5 TRCN0000055948 GCTCAGAGATTGCACAGGTAA pLKO.1 7242 CDS 100% 4.950 2.970 N DCHS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003737.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.