Transcript: Human NM_003750.4

Homo sapiens eukaryotic translation initiation factor 3 subunit A (EIF3A), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
EIF3A (8661)
Length:
6659
CDS:
142..4290

Additional Resources:

NCBI RefSeq record:
NM_003750.4
NBCI Gene record:
EIF3A (8661)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003750.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074804 CGACACGAATTGGCCTTATTA pLKO.1 1235 CDS 100% 15.000 21.000 N EIF3A n/a
2 TRCN0000074805 CGTGCTGATGATGATCGGTTT pLKO.1 3592 CDS 100% 4.050 5.670 N EIF3A n/a
3 TRCN0000363727 CGTGCTGATGATGATCGGTTT pLKO_005 3592 CDS 100% 4.050 5.670 N EIF3A n/a
4 TRCN0000074806 GCCAACGAATTTCTTGAGGTT pLKO.1 184 CDS 100% 2.640 3.696 N EIF3A n/a
5 TRCN0000344671 GACACGAATTGGCCTTATTAA pLKO_005 1236 CDS 100% 15.000 10.500 N EIF3A n/a
6 TRCN0000305214 GATCACATTCAAGGATTATTA pLKO_005 4333 3UTR 100% 15.000 10.500 N Eif3a n/a
7 TRCN0000369348 ATCTACACTCCATCGTCTTTA pLKO_005 1020 CDS 100% 13.200 9.240 N EIF3A n/a
8 TRCN0000369347 GATGTTGTTAGGGCATATTTG pLKO_005 403 CDS 100% 13.200 9.240 N EIF3A n/a
9 TRCN0000074807 GCGCCTTGAGAGTCTGAATAT pLKO.1 1881 CDS 100% 13.200 9.240 N EIF3A n/a
10 TRCN0000333086 GCGCCTTGAGAGTCTGAATAT pLKO_005 1881 CDS 100% 13.200 9.240 N EIF3A n/a
11 TRCN0000074803 GAATGAAGTAAGGTTCTGTTA pLKO.1 4658 3UTR 100% 4.950 3.465 N EIF3A n/a
12 TRCN0000333087 GAATGAAGTAAGGTTCTGTTA pLKO_005 4658 3UTR 100% 4.950 3.465 N EIF3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003750.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.