Transcript: Human NM_003806.4

Homo sapiens harakiri, BCL2 interacting protein (HRK), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
HRK (8739)
Length:
5789
CDS:
135..410

Additional Resources:

NCBI RefSeq record:
NM_003806.4
NBCI Gene record:
HRK (8739)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003806.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033557 GCTAGGCGACGAGCTGCACCA pLKO.1 251 CDS 100% 0.000 0.000 N HRK n/a
2 TRCN0000033556 CAAGGCGCTAGGCGACGAGCT pLKO.1 245 CDS 100% 0.000 0.000 N HRK n/a
3 TRCN0000033555 CGAGCTGCACCAGCGCACCAT pLKO.1 260 CDS 100% 0.000 0.000 N HRK n/a
4 TRCN0000033558 GCTCGGCAGGCGGAACTTGTA pLKO.1 389 CDS 100% 0.000 0.000 N HRK n/a
5 TRCN0000033554 GCTGCTCGGCAGGCGGAACTT pLKO.1 386 CDS 100% 0.000 0.000 N HRK n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4119 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4119 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003806.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.