Transcript: Human NM_003862.3

Homo sapiens fibroblast growth factor 18 (FGF18), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
FGF18 (8817)
Length:
1998
CDS:
554..1177

Additional Resources:

NCBI RefSeq record:
NM_003862.3
NBCI Gene record:
FGF18 (8817)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003862.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372248 CTCACGCAAAGGGACTGTAGT pLKO_005 1385 3UTR 100% 4.950 6.930 N FGF18 n/a
2 TRCN0000033633 GCCCTTCAAGTACACGACGGT pLKO.1 1114 CDS 100% 0.220 0.308 N FGF18 n/a
3 TRCN0000372251 ACCTGTGCATGAACCGCAAAG pLKO_005 873 CDS 100% 6.000 4.200 N FGF18 n/a
4 TRCN0000033631 ACAGACACCTTCGGTAGTCAA pLKO.1 821 CDS 100% 4.950 3.465 N FGF18 n/a
5 TRCN0000033630 CAGCAAGGAGTGTGTGTTCAT pLKO.1 922 CDS 100% 4.950 3.465 N FGF18 n/a
6 TRCN0000372314 CCCTGATGTCGGCTAAGTACT pLKO_005 972 CDS 100% 4.950 3.465 N FGF18 n/a
7 TRCN0000372313 GAAGGTTCTGGAGAACAACTA pLKO_005 946 CDS 100% 4.950 3.465 N FGF18 n/a
8 TRCN0000033629 CGTGCATTTCATGAAGCGCTA pLKO.1 1066 CDS 100% 2.160 1.512 N FGF18 n/a
9 TRCN0000033632 CCGGACCAGTGGGAAACACAT pLKO.1 730 CDS 100% 1.650 1.155 N FGF18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003862.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.