Transcript: Human NM_003868.3

Homo sapiens fibroblast growth factor 16 (FGF16), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
FGF16 (8823)
Length:
1666
CDS:
287..910

Additional Resources:

NCBI RefSeq record:
NM_003868.3
NBCI Gene record:
FGF16 (8823)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003868.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059033 GCTTCGGAATCCTGGAGTTTA pLKO.1 555 CDS 100% 13.200 18.480 N FGF16 n/a
2 TRCN0000059035 GCCTCAACCTTGTACAAACAT pLKO.1 728 CDS 100% 5.625 7.875 N FGF16 n/a
3 TRCN0000059034 CGGACTCAGAGAGACAGTATT pLKO.1 750 CDS 100% 13.200 9.240 N FGF16 n/a
4 TRCN0000372361 ATGAGCGAGGAGAACTCTATG pLKO_005 639 CDS 100% 10.800 7.560 N FGF16 n/a
5 TRCN0000067085 TCCGGGAACAGTTTGAAGAAA pLKO.1 690 CDS 100% 5.625 3.938 N Fgf16 n/a
6 TRCN0000059036 CGAAGAAACTCACACGTGAAT pLKO.1 663 CDS 100% 4.950 3.465 N FGF16 n/a
7 TRCN0000378767 TTCCGGGAACAGTTTGAAGAA pLKO_005 689 CDS 100% 4.950 3.465 N FGF16 n/a
8 TRCN0000059037 GCGTGGCTCACCCACAGACTT pLKO.1 424 CDS 100% 0.000 0.000 N FGF16 n/a
9 TRCN0000378768 CTCCTTGGACTGGGATCTACA pLKO_005 313 CDS 100% 4.950 2.970 N FGF16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003868.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.