Transcript: Human NM_003890.2

Homo sapiens Fc fragment of IgG binding protein (FCGBP), mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
FCGBP (8857)
Length:
16407
CDS:
9..16226

Additional Resources:

NCBI RefSeq record:
NM_003890.2
NBCI Gene record:
FCGBP (8857)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003890.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057460 CCTCCCAATCTCGCTATGATT pLKO.1 781 CDS 100% 5.625 7.875 N FCGBP n/a
2 TRCN0000057459 GCCAGGAATGTCAAGGAGTTT pLKO.1 465 CDS 100% 4.950 3.465 N FCGBP n/a
3 TRCN0000057461 CCTGTAACTATGTGCTGGCAA pLKO.1 5089 CDS 100% 2.640 1.848 N FCGBP n/a
4 TRCN0000419843 GGGCTGTGTGGCAACTATAAT pLKO_005 1833 CDS 100% 15.000 9.000 N FCGBP n/a
5 TRCN0000057462 GCAGGTGATGTGGTAGAGTTT pLKO.1 879 CDS 100% 4.950 2.970 N FCGBP n/a
6 TRCN0000057458 CCCTTGAAAGATTGCATCTTT pLKO.1 4455 CDS 100% 0.563 0.338 N FCGBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003890.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.