Transcript: Human NM_003968.4

Homo sapiens ubiquitin like modifier activating enzyme 3 (UBA3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
UBA3 (9039)
Length:
2111
CDS:
13..1404

Additional Resources:

NCBI RefSeq record:
NM_003968.4
NBCI Gene record:
UBA3 (9039)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003968.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272811 TTTATCCACCACAGGTTAATT pLKO_005 692 CDS 100% 15.000 21.000 N UBA3 n/a
2 TRCN0000007254 CGACACTTTCTATCGACAATT pLKO.1 468 CDS 100% 13.200 18.480 N UBA3 n/a
3 TRCN0000272812 CGACACTTTCTATCGACAATT pLKO_005 468 CDS 100% 13.200 18.480 N UBA3 n/a
4 TRCN0000007255 CCTCTATTGAAGAACGAACAA pLKO.1 1268 CDS 100% 4.950 6.930 N UBA3 n/a
5 TRCN0000272752 CCTCTATTGAAGAACGAACAA pLKO_005 1268 CDS 100% 4.950 6.930 N UBA3 n/a
6 TRCN0000272753 ATCTGACATCTGGAGTATATT pLKO_005 1809 3UTR 100% 15.000 10.500 N UBA3 n/a
7 TRCN0000007257 CCACAGACTGTACTATTCAAA pLKO.1 1366 CDS 100% 5.625 3.938 N UBA3 n/a
8 TRCN0000284845 CCACAGACTGTACTATTCAAA pLKO_005 1366 CDS 100% 5.625 3.938 N UBA3 n/a
9 TRCN0000007256 GCCTGGAATGACTGCTTGTAT pLKO.1 654 CDS 100% 5.625 3.938 N UBA3 n/a
10 TRCN0000007253 GAGCAAATGTATTGCTTCTTT pLKO.1 1636 3UTR 100% 0.563 0.394 N UBA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003968.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.