Transcript: Human NM_004032.3

Homo sapiens D-aspartate oxidase (DDO), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
DDO (8528)
Length:
1953
CDS:
114..962

Additional Resources:

NCBI RefSeq record:
NM_004032.3
NBCI Gene record:
DDO (8528)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004032.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439607 TGGACACTCACTCGGCGAATA pLKO_005 414 CDS 100% 10.800 15.120 N DDO n/a
2 TRCN0000435322 ATTAATGGCATAGGGCATAAA pLKO_005 1283 3UTR 100% 13.200 10.560 N DDO n/a
3 TRCN0000419732 CAAGGACCTATGCAGATTTAT pLKO_005 1362 3UTR 100% 15.000 10.500 N DDO n/a
4 TRCN0000046138 CCATCATTTCAGACAAGTTTA pLKO.1 208 CDS 100% 13.200 9.240 N DDO n/a
5 TRCN0000046142 CATTCCCAAGTCAAACCTGTA pLKO.1 941 CDS 100% 4.050 2.835 N DDO n/a
6 TRCN0000046139 GCAGAGAGATTCTTTCCCGAT pLKO.1 688 CDS 100% 2.160 1.512 N DDO n/a
7 TRCN0000046141 GTCCTTTGACATCGTGGTCAA pLKO.1 458 CDS 100% 0.405 0.284 N DDO n/a
8 TRCN0000046140 GAAACCTTTAATCACCTCTTT pLKO.1 321 CDS 100% 4.950 2.970 N DDO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004032.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.