Transcript: Human NM_004040.4

Homo sapiens ras homolog family member B (RHOB), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
RHOB (388)
Length:
2367
CDS:
393..983

Additional Resources:

NCBI RefSeq record:
NM_004040.4
NBCI Gene record:
RHOB (388)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004040.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047852 GCGCATCCAAGCCTACGACTA pLKO.1 839 CDS 100% 1.350 1.890 N RHOB n/a
2 TRCN0000291561 GCGCATCCAAGCCTACGACTA pLKO_005 839 CDS 100% 1.350 1.890 N RHOB n/a
3 TRCN0000294874 CAACTGCTGCAAGGTGCTATG pLKO_005 962 CDS 100% 6.000 4.200 N Rhob n/a
4 TRCN0000331154 CAACTGCTGCAAGGTGCTATG pLKO_005 962 CDS 100% 6.000 4.200 N RHOB n/a
5 TRCN0000047849 CCTGCTGATCGTGTTCAGTAA pLKO.1 452 CDS 100% 4.950 3.465 N RHOB n/a
6 TRCN0000291562 CCTGCTGATCGTGTTCAGTAA pLKO_005 452 CDS 100% 4.950 3.465 N RHOB n/a
7 TRCN0000047848 CGTGTTCAGTAAGGACGAGTT pLKO.1 461 CDS 100% 4.050 2.835 N RHOB n/a
8 TRCN0000047850 CGACGTCATTCTCATGTGCTT pLKO.1 623 CDS 100% 2.640 1.848 N RHOB n/a
9 TRCN0000308285 TGAAGCACTTCTGTCCCAATG pLKO_005 700 CDS 100% 6.000 3.600 N RHOB n/a
10 TRCN0000047851 CCCACCGTCTTCGAGAACTAT pLKO.1 498 CDS 100% 5.625 3.375 N RHOB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004040.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.