Transcript: Human NM_004185.4

Homo sapiens Wnt family member 2B (WNT2B), transcript variant WNT-2B1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
WNT2B (7482)
Length:
2925
CDS:
998..2116

Additional Resources:

NCBI RefSeq record:
NM_004185.4
NBCI Gene record:
WNT2B (7482)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004185.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033377 CCCTCATGAACTTACATAATA pLKO.1 1584 CDS 100% 15.000 21.000 N WNT2B n/a
2 TRCN0000033374 CGGACTGATCTTGTCTACTTT pLKO.1 1826 CDS 100% 5.625 7.875 N WNT2B n/a
3 TRCN0000088924 CCGGACTGATCTTGTCTACTT pLKO.1 1825 CDS 100% 4.950 6.930 N Wnt2b n/a
4 TRCN0000033375 GCACGAGTGATCTGTGACAAT pLKO.1 1142 CDS 100% 4.950 6.930 N WNT2B n/a
5 TRCN0000373979 TAGGCTACCACATTCTATTAT pLKO_005 2603 3UTR 100% 15.000 10.500 N WNT2B n/a
6 TRCN0000033376 CGGTGCAAGGAATGCAGAAAT pLKO.1 2036 CDS 100% 13.200 9.240 N WNT2B n/a
7 TRCN0000033378 CTGTGACAATATCCCTGGTTT pLKO.1 1153 CDS 100% 4.950 3.465 N WNT2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004185.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.