Transcript: Human NM_004262.3

Homo sapiens transmembrane serine protease 11D (TMPRSS11D), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
TMPRSS11D (9407)
Length:
2787
CDS:
70..1326

Additional Resources:

NCBI RefSeq record:
NM_004262.3
NBCI Gene record:
TMPRSS11D (9407)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004262.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373703 TGGATTGCCACGTCTGGTATT pLKO_005 781 CDS 100% 10.800 15.120 N TMPRSS11D n/a
2 TRCN0000074005 GTCAGTTAAATTCACCAGCTA pLKO.1 257 CDS 100% 2.640 3.696 N TMPRSS11D n/a
3 TRCN0000373704 TAATGCACCACATAGTTATAA pLKO_005 1080 CDS 100% 15.000 10.500 N TMPRSS11D n/a
4 TRCN0000074004 GCTGCAGCAAATTGGCTTATT pLKO.1 559 CDS 100% 13.200 9.240 N TMPRSS11D n/a
5 TRCN0000373783 GTGGAGGCAGCCTGATCAATA pLKO_005 704 CDS 100% 13.200 9.240 N TMPRSS11D n/a
6 TRCN0000074006 CAGCCTACCTTGACTGGATTA pLKO.1 1286 CDS 100% 10.800 7.560 N TMPRSS11D n/a
7 TRCN0000074003 CCACAACATTTCCTAAACTAA pLKO.1 803 CDS 100% 5.625 3.938 N TMPRSS11D n/a
8 TRCN0000074007 GAAATAACAATGGAGCATCAA pLKO.1 440 CDS 100% 4.950 3.465 N TMPRSS11D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004262.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.