Transcript: Human NM_004278.4

Homo sapiens phosphatidylinositol glycan anchor biosynthesis class L (PIGL), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PIGL (9487)
Length:
1289
CDS:
18..776

Additional Resources:

NCBI RefSeq record:
NM_004278.4
NBCI Gene record:
PIGL (9487)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004278.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294169 GCAATCACATTGCTCTGTATG pLKO_005 481 CDS 100% 10.800 15.120 N PIGL n/a
2 TRCN0000051507 TCTCTGCTTCATACGCAGGAT pLKO.1 615 CDS 100% 2.640 3.696 N PIGL n/a
3 TRCN0000051506 GATTATTGACAACAGGGATTT pLKO.1 338 CDS 100% 10.800 8.640 N PIGL n/a
4 TRCN0000286769 GATTATTGACAACAGGGATTT pLKO_005 338 CDS 100% 10.800 8.640 N PIGL n/a
5 TRCN0000294170 TGGCCTGGCACTGGCTTATTT pLKO_005 841 3UTR 100% 15.000 10.500 N PIGL n/a
6 TRCN0000294171 TCAGAAGGGAAGTTACCTAAA pLKO_005 522 CDS 100% 10.800 7.560 N PIGL n/a
7 TRCN0000051504 CTCCCGGTACATGAGAATCAA pLKO.1 737 CDS 100% 5.625 3.938 N PIGL n/a
8 TRCN0000051503 CTTCAGCACATAGAAGTGAAT pLKO.1 411 CDS 100% 4.950 3.465 N PIGL n/a
9 TRCN0000051505 GAGACTCGTAAGAAAGAACTT pLKO.1 273 CDS 100% 4.950 3.465 N PIGL n/a
10 TRCN0000286849 GAGACTCGTAAGAAAGAACTT pLKO_005 273 CDS 100% 4.950 3.465 N PIGL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004278.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.