Transcript: Human NM_004285.4

Homo sapiens hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase (H6PD), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-24
Taxon:
Homo sapiens (human)
Gene:
H6PD (9563)
Length:
9147
CDS:
304..2679

Additional Resources:

NCBI RefSeq record:
NM_004285.4
NBCI Gene record:
H6PD (9563)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004285.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234330 ACCGGGTGGACCATTACTTAG pLKO_005 902 CDS 100% 10.800 15.120 N H6PD n/a
2 TRCN0000220338 CGGGTGGAGATCATCATGAAA pLKO.1 1009 CDS 100% 5.625 7.875 N H6PD n/a
3 TRCN0000220336 CCCTTCGCCTATGAAGACATT pLKO.1 739 CDS 100% 4.950 6.930 N H6PD n/a
4 TRCN0000220335 CGCTCGGATCTTGTTCAAGAA pLKO.1 1407 CDS 100% 4.950 3.960 N H6PD n/a
5 TRCN0000234333 CTCTGGATCAGGCAGATATAA pLKO_005 4404 3UTR 100% 15.000 10.500 N H6PD n/a
6 TRCN0000218953 ACCTGGCTAAGAAGTACTTAT pLKO_005 410 CDS 100% 13.200 9.240 N H6PD n/a
7 TRCN0000234332 ATGGCCGTCTGTTGGACTTTG pLKO_005 1823 CDS 100% 10.800 7.560 N H6PD n/a
8 TRCN0000234331 CTCCGTCCTCTTATCCCATAT pLKO_005 1677 CDS 100% 10.800 7.560 N H6PD n/a
9 TRCN0000220337 CTGATCTCTAAGCTGGCTAAT pLKO.1 1990 CDS 100% 10.800 7.560 N H6PD n/a
10 TRCN0000220339 CCGTCTGTTGGACTTTGAGTT pLKO.1 1827 CDS 100% 4.950 3.465 N H6PD n/a
11 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 4814 3UTR 100% 4.950 2.475 Y n/a
12 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 8844 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4887 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4887 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004285.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.