Transcript: Human NM_004299.6

Homo sapiens ATP binding cassette subfamily B member 7 (ABCB7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ABCB7 (22)
Length:
4595
CDS:
12..2273

Additional Resources:

NCBI RefSeq record:
NM_004299.6
NBCI Gene record:
ABCB7 (22)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004299.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059355 GCACAGAGATATGATGGATTT pLKO.1 1071 CDS 100% 10.800 8.640 N ABCB7 n/a
2 TRCN0000315708 GCACAGAGATATGATGGATTT pLKO_005 1071 CDS 100% 10.800 8.640 N ABCB7 n/a
3 TRCN0000059353 GCAGATAATGATGCAGGTAAT pLKO.1 987 CDS 100% 10.800 7.560 N ABCB7 n/a
4 TRCN0000315641 GCAGATAATGATGCAGGTAAT pLKO_005 987 CDS 100% 10.800 7.560 N ABCB7 n/a
5 TRCN0000059354 CCTCATAGTATCTATTCAGAA pLKO.1 2103 CDS 100% 4.950 3.465 N ABCB7 n/a
6 TRCN0000315642 CCTCATAGTATCTATTCAGAA pLKO_005 2103 CDS 100% 4.950 3.465 N ABCB7 n/a
7 TRCN0000059356 GCATTTATCTTGCTGGTCAAA pLKO.1 1597 CDS 100% 4.950 3.465 N ABCB7 n/a
8 TRCN0000315760 GCATTTATCTTGCTGGTCAAA pLKO_005 1597 CDS 100% 4.950 3.465 N ABCB7 n/a
9 TRCN0000059357 GCCATGAAGGATGTGGTCAAA pLKO.1 1962 CDS 100% 4.950 3.465 N ABCB7 n/a
10 TRCN0000315707 GCCATGAAGGATGTGGTCAAA pLKO_005 1962 CDS 100% 4.950 3.465 N ABCB7 n/a
11 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 3308 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
12 TRCN0000116737 CCTCCCAAGTAGCTGGAATTA pLKO.1 2966 3UTR 100% 13.200 6.600 Y CLDN18 n/a
13 TRCN0000116227 CCTCCCAAAGTTCTGGGATTA pLKO.1 3101 3UTR 100% 1.080 0.540 Y ELOVL7 n/a
14 TRCN0000164591 CCTCCCAAAGTTCTGGGATTA pLKO.1 3101 3UTR 100% 1.080 0.540 Y TNNI1 n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3416 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3416 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004299.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.