Transcript: Human NM_004326.4

Homo sapiens BCL9 transcription coactivator (BCL9), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
BCL9 (607)
Length:
6189
CDS:
652..4932

Additional Resources:

NCBI RefSeq record:
NM_004326.4
NBCI Gene record:
BCL9 (607)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004326.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356325 GCGGAAGCCCTTGGATATATC pLKO_005 3177 CDS 100% 13.200 18.480 N BCL9 n/a
2 TRCN0000356398 TGGATTTGCAGGCATGATAAA pLKO_005 2340 CDS 100% 13.200 10.560 N BCL9 n/a
3 TRCN0000005512 CCTGAGGAGATGCTGAAATTA pLKO.1 2881 CDS 100% 15.000 10.500 N BCL9 n/a
4 TRCN0000356324 TTTGATCTATCCCGCATTATT pLKO_005 4351 CDS 100% 15.000 10.500 N BCL9 n/a
5 TRCN0000005513 CCAACTCAACTCCCAACAATA pLKO.1 1565 CDS 100% 13.200 9.240 N BCL9 n/a
6 TRCN0000005509 GCTGCAATACACAGTGTTATT pLKO.1 5786 3UTR 100% 13.200 9.240 N BCL9 n/a
7 TRCN0000314150 ATCCTTGTCAAGATGAGATTC pLKO_005 4955 3UTR 100% 10.800 7.560 N Bcl9 n/a
8 TRCN0000005510 GCAGGCATGATAAACTCTGAA pLKO.1 2347 CDS 100% 4.950 3.465 N BCL9 n/a
9 TRCN0000005511 CCTCTGTGAATATCCCTGGAA pLKO.1 3587 CDS 100% 2.640 1.848 N BCL9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004326.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.