Transcript: Human NM_004360.5

Homo sapiens cadherin 1 (CDH1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CDH1 (999)
Length:
4811
CDS:
125..2773

Additional Resources:

NCBI RefSeq record:
NM_004360.5
NBCI Gene record:
CDH1 (999)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004360.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237844 ACACCCGGGACAACGTTTATT pLKO_005 2364 CDS 100% 15.000 21.000 N CDH1 n/a
2 TRCN0000237841 AGATTGCACCGGTCGACAAAG pLKO_005 298 CDS 100% 10.800 15.120 N CDH1 n/a
3 TRCN0000237843 GAACGAGGCTAACGTCGTAAT pLKO_005 1282 CDS 100% 10.800 15.120 N CDH1 n/a
4 TRCN0000237842 TTTCGGCAGTTCAAGCTATAT pLKO_005 4624 3UTR 100% 13.200 10.560 N CDH1 n/a
5 TRCN0000237840 ATACCAGAACCTCGAACTATA pLKO_005 1904 CDS 100% 13.200 9.240 N CDH1 n/a
6 TRCN0000039667 CCAACCCAAGAATCTATCATT pLKO.1 2057 CDS 100% 5.625 3.938 N CDH1 n/a
7 TRCN0000039665 CCAAGCAGAATTGCTCACATT pLKO.1 529 CDS 100% 4.950 3.465 N CDH1 n/a
8 TRCN0000039666 CGATTCAAAGTGGGCACAGAT pLKO.1 344 CDS 100% 4.950 3.465 N CDH1 n/a
9 TRCN0000039663 GCAGAAATTATTGGGCTCTTT pLKO.1 3858 3UTR 100% 4.950 3.465 N CDH1 n/a
10 TRCN0000039664 CCAGTGAACAACGATGGCATT pLKO.1 1409 CDS 100% 4.050 2.430 N CDH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004360.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.