Transcript: Human NM_004376.7

Homo sapiens cytochrome c oxidase assembly homolog COX15 (COX15), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
COX15 (1355)
Length:
3791
CDS:
79..1245

Additional Resources:

NCBI RefSeq record:
NM_004376.7
NBCI Gene record:
COX15 (1355)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004376.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046027 CTCCTACAGTTGAGACGATTT pLKO.1 847 CDS 100% 10.800 15.120 N COX15 n/a
2 TRCN0000286465 CTCCTACAGTTGAGACGATTT pLKO_005 847 CDS 100% 10.800 15.120 N COX15 n/a
3 TRCN0000298618 CTCGATGGTAGATTGGCATTT pLKO_005 369 CDS 100% 10.800 15.120 N COX15 n/a
4 TRCN0000046026 CGTGGCATGAAAGGACGTGTT pLKO.1 610 CDS 100% 4.050 5.670 N COX15 n/a
5 TRCN0000293902 GTGAAGGAACTAGGGATATTT pLKO_005 1684 3UTR 100% 15.000 12.000 N COX15 n/a
6 TRCN0000046023 GCCCTGTCTTATTCAACTTTA pLKO.1 1181 CDS 100% 13.200 9.240 N COX15 n/a
7 TRCN0000293901 GCTAGATGCTGGGCTTGTTTA pLKO_005 927 CDS 100% 13.200 9.240 N COX15 n/a
8 TRCN0000046025 CCTTCCTAGAAGGACCAAGAT pLKO.1 1122 CDS 100% 4.950 3.465 N COX15 n/a
9 TRCN0000046024 GCAGTTATTCTTGGTGGAGTA pLKO.1 325 CDS 100% 4.050 2.835 N COX15 n/a
10 TRCN0000298235 GCAGTTATTCTTGGTGGAGTA pLKO_005 325 CDS 100% 4.050 2.835 N COX15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004376.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.