Transcript: Human NM_004380.3

Homo sapiens CREB binding protein (CREBBP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
CREBBP (1387)
Length:
10790
CDS:
798..8126

Additional Resources:

NCBI RefSeq record:
NM_004380.3
NBCI Gene record:
CREBBP (1387)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004380.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356081 ATCGCCACGTCCCTTAGTAAC pLKO_005 7800 CDS 100% 10.800 15.120 N CREBBP n/a
2 TRCN0000356082 CGTTTACCATGAGATCCTTAT pLKO_005 5141 CDS 100% 10.800 15.120 N CREBBP n/a
3 TRCN0000011027 CGTGCCAAATATGTCTCAGAT pLKO.1 1760 CDS 100% 4.950 3.960 N CREBBP n/a
4 TRCN0000356053 GGGATGAATATTATCACTTAT pLKO_005 2737 CDS 100% 13.200 9.240 N CREBBP n/a
5 TRCN0000231201 TAACTCTGGCCATAGCTTAAT pLKO_005 1370 CDS 100% 13.200 9.240 N Crebbp n/a
6 TRCN0000367481 TAACTCTGGCCATAGCTTAAT pLKO_005 1370 CDS 100% 13.200 9.240 N CREBBP n/a
7 TRCN0000006485 CCCGATAACTTTGTGATGTTT pLKO.1 8582 3UTR 100% 5.625 3.938 N CREBBP n/a
8 TRCN0000006486 GCTATCAGAATAGGTATCATT pLKO.1 4483 CDS 100% 5.625 3.938 N CREBBP n/a
9 TRCN0000006488 CCGTTTACCATGAGATCCTTA pLKO.1 5140 CDS 100% 4.950 3.465 N CREBBP n/a
10 TRCN0000006487 GCGTTTACATAAACAAGGCAT pLKO.1 2810 CDS 100% 2.640 1.848 N CREBBP n/a
11 TRCN0000158276 CAGCAACAACAGCAGCAACAA pLKO.1 7413 CDS 100% 4.950 2.475 Y RBMS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004380.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.